Find the EMA’s orphan designation and approvals for November here.
Find the FDA’s October designations here.
| FDA – 13/11/2014 |
| Generic Name: |
stem/progenitor cells derived from ex vivo expanded allogeneic umbilical cord blood cells |
| Trade Name: |
Nicord(R) |
| Orphan Designation: |
Treatment of acute lymphoblastic leukemia. |
| Orphan Designation Status: |
Designated |
| FDA Orphan Approved: |
|
| Sponsor: |
Gambia Cell |
| FDA – 13/11/2014 |
| Generic Name: |
stem/progenitor cells derived from ex vivo expanded allogeneic umbilical cord blood cells |
| Trade Name: |
Nicord(R) |
| Orphan Designation: |
Treatment of myelodysplastic syndrome. |
| Orphan Designation Status: |
Designated |
| FDA Orphan Approved: |
|
| Sponsor: |
Gamida Cell |
| FDA – 17/11/2014 |
| Generic Name: |
trehalose |
| Trade Name: |
N/A |
| Orphan Designation: |
Treatment of spinal cerebellar ataxia type 3 (also known as SCA3 or Machado Joseph disease) |
| Orphan Designation Status: |
Designated |
| FDA Orphan Approved: |
|
| Sponsor: |
BioBlast Pharma |
| FDA – 17/11/2014 |
| Generic Name: |
recombinant neuroglobin (rNgb) containing mutations H64Q/C46G/C55S/C120S |
| Trade Name: |
N/A |
| Orphan Designation: |
Treatment of patients with carbon monoxide poisoning |
| Orphan Designation Status: |
Designated |
| FDA Orphan Approved: |
|
| Sponsor: |
University of Pittsburgh |
| FDA – 17/11/2014 |
| Generic Name: |
vatiquinone |
| Trade Name: |
Vincerinone |
| Orphan Designation: |
Treatment of Rett syndrome |
| Orphan Designation Status: |
Designated |
| FDA Orphan Approved: |
|
| Sponsor: |
Edison Pharmaceuticals |
| FDA – 17/11/2014 |
| Generic Name: |
veltuzumab |
| Trade Name: |
N/A |
| Orphan Designation: |
Treatment of pemphigus |
| Orphan Designation Status: |
Designated |
| FDA Orphan Approved: |
|
| Sponsor: |
Immunomedics |
| FDA – 24/11/2014 |
| Generic Name: |
oxytocin |
| Trade Name: |
N/A |
| Orphan Designation: |
Treatment of Prader-Willi syndrome |
| Orphan Designation Status: |
Designated |
| FDA Orphan Approved: |
|
| Sponsor: |
Pr Maithe Tauber |
| FDA – 13/11/2014 |
| Generic Name: |
Autologous CD3+ T cells transduced with retroviral vector containing a chimeric antigen receptor directed against CD19 (Autologous CD3+ T cells containing CD19 chimeric antigen receptor) |
| Trade Name: |
N/A |
| Orphan Designation: |
Treatment of acute lymphoblastic leukemia (ALL) |
| Orphan Designation Status: |
Designated |
| FDA Orphan Approved: |
|
| Sponsor: |
Juno Therapeutics |
| FDA – 17/11/2014 |
| Generic Name: |
(S)-3-((3-(1-((6-((3,4-dimethoxyphenyl)pryazin-2-yl)amino)ethyl)phenyl)carbamoyl)-5-methylpridin-1-ium |
| Trade Name: |
N/A |
| Orphan Designation: |
Treatment of pulmonary arterial hypertension |
| Orphan Designation Status: |
Designated |
| FDA Orphan Approved: |
|
| Sponsor: |
Pulmokine |
| FDA – 17/11/2014 |
| Generic Name: |
(S)-6-hydroxy-2,5,7,8-tetramethyl-N-((R)-piperidin-3-yl)chroman-2-carboxamide hydrochloride |
| Trade Name: |
N/A |
| Orphan Designation: |
Treatment of inherited mitochondrial respiratory chain diseases |
| Orphan Designation Status: |
Designated |
| FDA Orphan Approved: |
|
| Sponsor: |
Khondrion |
| FDA – 14/11/2014 |
| Generic Name: |
(S)-perillyl alcohol temozolomide |
| Trade Name: |
N/A |
| Orphan Designation: |
Treatment of glioma |
| Orphan Designation Status: |
Designated |
| FDA Orphan Approved: |
|
| Sponsor: |
NeOnc Technologies |
| FDA – 25/11/2014 |
| Generic Name: |
225Ac-lintuzumab |
| Trade Name: |
N/A |
| Orphan Designation: |
Treatment of acute myelogenous leukemia |
| Orphan Designation Status: |
Designated |
| FDA Orphan Approved: |
|
| Sponsor: |
Actinium Pharmaceuticals |
| FDA – 17/11/2014 |
| Generic Name: |
N-(9-methoxynonyl)-1-deoxynojirimycin hydrochloride |
| Trade Name: |
N/A |
| Orphan Designation: |
Treatment of acute dengue illness (inclusive of acute dengue illness, dengue fever, dengue hemorrhagic fever, and dengue shock syndrome) |
| Orphan Designation Status: |
Designated |
| FDA Orphan Approved: |
|
| Sponsor: |
Unither Virology |
| FDA – 24/11/2014 |
| Generic Name: |
PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5’TCATCATTTTGTCATTTTGTCATT 3′ |
| Trade Name: |
Imt504 |
| Orphan Designation: |
Treatment of rabies virus infections |
| Orphan Designation Status: |
Designated |
| FDA Orphan Approved: |
|
| Sponsor: |
Mid-Atlantic BioTherapeutics |
| FDA – 17/11/2014 |
| Generic Name: |
N-(2-((4Z,7Z,10Z,13Z,16Z,19Z)-docosa-4,7,10,13,16,19-hexaenamido)ethyl)-2-hydroxybenzamide |
| Trade Name: |
N/A |
| Orphan Designation: |
Treatment of Duchenne muscular dystrophy |
| Orphan Designation Status: |
Designated |
| FDA Orphan Approved: |
|
| Sponsor: |
Catabasis Pharmaceuticals |
| FDA – 17/11/2014 |
| Generic Name: |
N-(2-amino-2-oxoethyl)-2-(2-((4-fluorophenethyl)amino)-N-isobutylacetamido)-N-(3-(2-oxopyrrolidin-1-yl)propyl)acetamide N-({Carbamoylmethyl-[3-(2-oxo-pyrrolidin-1-yl)propyl}-carbamoyl}-methyl)-2-[2-(2-fluorophenyl)-ethylamino]-N-isobutyl-acetamide |
| Trade Name: |
N/A |
| Orphan Designation: |
Treatment of optic neuritis |
| Orphan Designation Status: |
Designated |
| FDA Orphan Approved: |
|
| Sponsor: |
Bionure Farma |
| FDA – 25/11/2014 |
| Generic Name: |
chimeric fusion protein of recombinant human alpha-N-acetylglucosaminidase and human insulin-like growth factor 2 |
| Trade Name: |
N/A |
| Orphan Designation: |
Treatment of mucopolysaccharidosis III Type B (MPS IIIB, Sanfilippo Syndrome Type B) |
| Orphan Designation Status: |
Designated |
| FDA Orphan Approved: |
|
| Sponsor: |
BioMarin Pharmaceutical |
| FDA – 17/11/2014 |
| Generic Name: |
antagonist of the complement 5a receptor |
| Trade Name: |
N/A |
| Orphan Designation: |
Treatment of atypical hemolytic uremic syndrome |
| Orphan Designation Status: |
Designated |
| FDA Orphan Approved: |
TEST |
| Sponsor: |
ChemoCentryx |
| FDA – 17/11/2014 |
| Generic Name: |
anti-tumor necrosis factor (TNF) polyclonal antibody (bovine) |
| Trade Name: |
N/A |
| Orphan Designation: |
Treatment of pediatric ulcerative colitis (0 through 16 years of age) |
| Orphan Designation Status: |
Designated |
| FDA Orphan Approved: |
TET |
| Sponsor: |
Avaxia Biologics |
| FDA – 05/11/2014 |
| Generic Name: |
d6-tetrabenazine, deutetrabenazine |
| Trade Name: |
N/A |
| Orphan Designation: |
Treatment of Huntington’s Disease |
| Orphan Designation Status: |
Designated |
| FDA Orphan Approved: |
|
| Sponsor: |
Auspex Pharmaceuticals |
| FDA – 17/11/2014 |
| Generic Name: |
cannabidiol |
| Trade Name: |
N/A |
| Orphan Designation: |
Treatment of pediatric schizophrenia (pediatrics is defined as 0 through 16 years of age) |
| Orphan Designation Status: |
Designated |
| FDA Orphan Approved: |
|
| Sponsor: |
Insys Therapeutics |
| FDA – 05/11/2014 |
| Generic Name: |
adeno-associated viral vector serotype 2 containing the human Rab escort protein 1 gene |
| Trade Name: |
N/A |
| Orphan Designation: |
Treatment of choroideremia |
| Orphan Designation Status: |
Designated |
| FDA Orphan Approved: |
|
| Sponsor: |
NightstaRx |
