FDA Orphan Drug Designation – November 2014

In Regulation & Government by CameronLeave a Comment

Find the EMA’s orphan designation and approvals for November here.

Find the FDA’s October designations here.

FDA – 13/11/2014
Generic Name: stem/progenitor cells derived from ex vivo expanded allogeneic umbilical cord blood cells
Trade Name: Nicord(R)
Orphan Designation: Treatment of Hodgkin lymphoma
Orphan Designation Status: Designated
FDA Orphan Approved:
Sponsor: Gambia Cell
FDA – 13/11/2014
Generic Name: stem/progenitor cells derived from ex vivo expanded allogeneic umbilical cord blood cells
Trade Name: Nicord(R)
Orphan Designation: Treatment of acute lymphoblastic leukemia.
Orphan Designation Status: Designated
FDA Orphan Approved:
Sponsor: Gambia Cell
FDA – 13/11/2014
Generic Name: stem/progenitor cells derived from ex vivo expanded allogeneic umbilical cord blood cells
Trade Name: Nicord(R)
Orphan Designation: Treatment of myelodysplastic syndrome.
Orphan Designation Status: Designated
FDA Orphan Approved:
Sponsor: Gamida Cell
FDA – 17/11/2014
Generic Name: trehalose
Trade Name: N/A
Orphan Designation: Treatment of spinal cerebellar ataxia type 3 (also known as SCA3 or Machado Joseph disease)
Orphan Designation Status: Designated
FDA Orphan Approved:
Sponsor: BioBlast Pharma
FDA – 17/11/2014
Generic Name: recombinant neuroglobin (rNgb) containing mutations H64Q/C46G/C55S/C120S
Trade Name: N/A
Orphan Designation: Treatment of patients with carbon monoxide poisoning
Orphan Designation Status: Designated
FDA Orphan Approved:
Sponsor: University of Pittsburgh
FDA – 17/11/2014
Generic Name: vatiquinone
Trade Name: Vincerinone
Orphan Designation: Treatment of Rett syndrome
Orphan Designation Status: Designated
FDA Orphan Approved:
Sponsor: Edison Pharmaceuticals
FDA – 17/11/2014
Generic Name: veltuzumab
Trade Name: N/A
Orphan Designation: Treatment of pemphigus
Orphan Designation Status: Designated
FDA Orphan Approved:
Sponsor: Immunomedics
FDA – 24/11/2014
Generic Name: oxytocin
Trade Name: N/A
Orphan Designation: Treatment of Prader-Willi syndrome
Orphan Designation Status: Designated
FDA Orphan Approved:
Sponsor: Pr Maithe Tauber
FDA – 13/11/2014
Generic Name: Autologous CD3+ T cells transduced with retroviral vector containing a chimeric antigen receptor directed against CD19 (Autologous CD3+ T cells containing CD19 chimeric antigen receptor)
Trade Name: N/A
Orphan Designation: Treatment of acute lymphoblastic leukemia (ALL)
Orphan Designation Status: Designated
FDA Orphan Approved:
Sponsor: Juno Therapeutics
FDA – 17/11/2014
Generic Name: (S)-3-((3-(1-((6-((3,4-dimethoxyphenyl)pryazin-2-yl)amino)ethyl)phenyl)carbamoyl)-5-methylpridin-1-ium
Trade Name: N/A
Orphan Designation: Treatment of pulmonary arterial hypertension
Orphan Designation Status: Designated
FDA Orphan Approved:
Sponsor: Pulmokine
FDA – 17/11/2014
Generic Name: (S)-6-hydroxy-2,5,7,8-tetramethyl-N-((R)-piperidin-3-yl)chroman-2-carboxamide hydrochloride
Trade Name: N/A
Orphan Designation: Treatment of inherited mitochondrial respiratory chain diseases
Orphan Designation Status: Designated
FDA Orphan Approved:
Sponsor: Khondrion
FDA – 14/11/2014
Generic Name: (S)-perillyl alcohol temozolomide
Trade Name: N/A
Orphan Designation: Treatment of glioma
Orphan Designation Status: Designated
FDA Orphan Approved:
Sponsor: NeOnc Technologies
FDA – 25/11/2014
Generic Name: 225Ac-lintuzumab
Trade Name: N/A
Orphan Designation: Treatment of acute myelogenous leukemia
Orphan Designation Status: Designated
FDA Orphan Approved:
Sponsor: Actinium Pharmaceuticals
FDA – 17/11/2014
Generic Name: N-(9-methoxynonyl)-1-deoxynojirimycin hydrochloride
Trade Name: N/A
Orphan Designation: Treatment of acute dengue illness (inclusive of acute dengue illness, dengue fever, dengue hemorrhagic fever, and dengue shock syndrome)
Orphan Designation Status: Designated
FDA Orphan Approved:
Sponsor: Unither Virology
FDA – 24/11/2014
Generic Name: PyNTTTTGT class of oligodeoxynucleotide with a 24-base single chain composed of nucleotide sequence 5’TCATCATTTTGTCATTTTGTCATT 3′
Trade Name: Imt504
Orphan Designation: Treatment of rabies virus infections
Orphan Designation Status: Designated
FDA Orphan Approved:
Sponsor: Mid-Atlantic BioTherapeutics
FDA – 17/11/2014
Generic Name: N-(2-((4Z,7Z,10Z,13Z,16Z,19Z)-docosa-4,7,10,13,16,19-hexaenamido)ethyl)-2-hydroxybenzamide
Trade Name: N/A
Orphan Designation: Treatment of Duchenne muscular dystrophy
Orphan Designation Status: Designated
FDA Orphan Approved:
Sponsor: Catabasis Pharmaceuticals
FDA – 17/11/2014
Generic Name: N-(2-amino-2-oxoethyl)-2-(2-((4-fluorophenethyl)amino)-N-isobutylacetamido)-N-(3-(2-oxopyrrolidin-1-yl)propyl)acetamide N-({Carbamoylmethyl-[3-(2-oxo-pyrrolidin-1-yl)propyl}-carbamoyl}-methyl)-2-[2-(2-fluorophenyl)-ethylamino]-N-isobutyl-acetamide
Trade Name: N/A
Orphan Designation: Treatment of optic neuritis
Orphan Designation Status: Designated
FDA Orphan Approved:
Sponsor: Bionure Farma
FDA – 25/11/2014
Generic Name: chimeric fusion protein of recombinant human alpha-N-acetylglucosaminidase and human insulin-like growth factor 2
Trade Name: N/A
Orphan Designation: Treatment of mucopolysaccharidosis III Type B (MPS IIIB, Sanfilippo Syndrome Type B)
Orphan Designation Status: Designated
FDA Orphan Approved:
Sponsor: BioMarin Pharmaceutical
FDA – 17/11/2014
Generic Name: antagonist of the complement 5a receptor
Trade Name: N/A
Orphan Designation: Treatment of atypical hemolytic uremic syndrome
Orphan Designation Status: Designated
FDA Orphan Approved: TEST
Sponsor: ChemoCentryx
FDA – 17/11/2014
Generic Name: anti-tumor necrosis factor (TNF) polyclonal antibody (bovine)
Trade Name: N/A
Orphan Designation: Treatment of pediatric ulcerative colitis (0 through 16 years of age)
Orphan Designation Status: Designated
FDA Orphan Approved: TET
Sponsor: Avaxia Biologics
FDA – 05/11/2014
Generic Name: d6-tetrabenazine, deutetrabenazine
Trade Name: N/A
Orphan Designation: Treatment of Huntington’s Disease
Orphan Designation Status: Designated
FDA Orphan Approved:
Sponsor: Auspex Pharmaceuticals
FDA – 17/11/2014
Generic Name: cannabidiol
Trade Name: N/A
Orphan Designation: Treatment of pediatric schizophrenia (pediatrics is defined as 0 through 16 years of age)
Orphan Designation Status: Designated
FDA Orphan Approved:
Sponsor: Insys Therapeutics
FDA – 05/11/2014
Generic Name: adeno-associated viral vector serotype 2 containing the human Rab escort protein 1 gene
Trade Name: N/A
Orphan Designation: Treatment of choroideremia
Orphan Designation Status: Designated
FDA Orphan Approved:
Sponsor: NightstaRx

Leave a Comment